Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Oligonucleotide sequences of primers used in real-time RT-PCR.

From: CD133+CXCR4+ colon cancer cells exhibit metastatic potential and predict poor prognosis of patients

Gene Sequence (5' → 3')
E-cadherin F TGAAGGTGACAGAGCCTCTGGA
  R TGGGTGAATTCGGGCTTGTT
Vimentin F TGGCCGACGCCATCAACACC
  R CACCTCGACGCGGGCTTTGT
N-cadherin F GCGCGTGAAGGTTTGCCAGTG
  R CCGGCGTTTCATCCATACCACAA
β-catenin F AGCCGACACCAAGAAGCAGAGATG
  R CGGCGCTGGGTATCCTGATGT
Snail F CCTCCCTGTCAGATGAGGAC
  R CCAGGCTGAGGTATTCCTTG
GAPDH F TGCCAAATATGATGACATCAAGAA
  R GGAGTGGGTGTCGCTGTTG