Skip to main content

Advertisement

Table 1 Primers used for PCR

From: Tissue-derived mesenchymal stromal cells used as vehicles for anti-tumor therapy exert different in vivoeffects on migration capacity and tumor growth

Primer Direction Sequence 5′→3′
hNIS Sense CCCATCGATGGAGGCCGTGGAGACCGG
  Anti-sense CCCATCGATGTCAGAGGTTTGTCTCCTGC
GADPH Sense CCCATCGATGTCAGAGGTTTGTCTCCTGC
  Anti-sense GGTCATGAGTCCTTCCACGAT
  1. GADPH glyceraldehyde-3-phosphate dehydrogenase, hNIS human sodium iodine symporter.