Skip to main content

Advertisement

Table 3 Primers used to amplify the migration-related genes

From: Tissue-derived mesenchymal stromal cells used as vehicles for anti-tumor therapy exert different in vivoeffects on migration capacity and tumor growth

Primer GenBank accession number Direction Sequence (5′ → 3′)
CXCR4 NM_003467 Sense TGGCCGACCTCCTCTTTGT
Anti-sense AGTTTGCCACGGCATCAACT
SDF-1 (CXCL12) NM_000609 Sense CCAACGTCAAGCATCTCAAAATT
Anti-sense AGCCGGGCTCAATCTGAAG
RANTES (CCL5) NM_002985 Sense TGCCCACATCAAGGAGTATTTCTA
Anti-sense GCACACACTTGGCGGTTCT
MCP-1 (CCL2) NM_002990 Sense GCGTGGTGTTGCTAACCTTCA
Anti-sense GGCTCTTCATTGGCTCAGCTT
MMP-2 NM_004530 Sense TTTTGATGACGATGAGCTATGGA
Anti-sense CCATCGGCGTTCCCATACT
18S NR_003286 Sense CGGCTACCACATCCAAGGAA
   Anti-sense GCTGGAATTACCGCGGCT