Skip to main content

Table 1 Oligonucleotide sequences used in the dual reporter gene assay, corresponding to the Y122X, G542X, R1162X and W1292X mutations and the TQ in frame control. Readthrough level before and after incubation with 600 μg/ml gentamicin.

From: In vitroprediction of stop-codon suppression by intravenous gentamicin in patients with cystic fibrosis: a pilot study

   Readthrough level (%)*
Mutation Oligonucleotides** 0 600 μg/ml gentamicin
Y122X w 5' CGCTCTATCGCGTAACTAGGCATAGGC 3';
c 5' GCCTATGCCTAGTTACGCGATAGAGCG 3'
0.52 1.6
W1282X w 5’ AATATAGTTCTTTGAGAAGGTGGAATC 3’
c 5’ GATTCCACCTTCTCAAAGAACTATATT 3’
0.115 0.35
R1162X w 5' CGATCTGTGAGCTGAGTCTTTAAGTTC 3';
c 5' GAACTTAAAGACTCAGCTCACAGATCG 3'
0.023 0.22
G542X w 5' ACTTTGCAACAGTGAAGGAAAGCCTTT 3';
c 5' AAAGGCTTCCTTCACTGTTGCAAAGT 3'
0.017 0.26
TQ: in frame control w 5' GCAGGAACACAACAGCAATTACAG 3'
c 5' CTGTAATTGCTGTTGTGTTCCTGC 3'
100 100
  1. *At least five independent experiments were performed with each construct and showed less than 20% variation.
  2. ** w and c refer to the sense and antisense strands respectively.