Skip to main content

Table 1 Details of oligonucleotide sequences of primers and probes used to quantify hypoxia inducible factor 1α (HIF-1α) mRNA splice variants by real-time quantitative reverse transcription PCR assays

From: Hypoxia inducible factor 1α gene (HIF-1α) splice variants: potential prognostic biomarkers in breast cancer

Oligonucleotide Position (exon) 5' Position Sequence (5' to 3') Primer/probe concentrations (nM) Amplicon size
  5 518 F: GTACCCTAACTAGCCGAGGAAGAA 300  
  6 597 R: GTGAATGTGGCCTGTGCAGT 300  
HIF-1α (total) 5 to 6 junction 544 P: ATGAACATAAAGTCTGCAACATGGAAGGTATTG 200 80 bp
  1 17 F: GCGCGAACGACAAGAAAAATAG 50  
  2 138 R: TGGCAACTGATGAGCAAGCT 300  
HIF-1α TAG 2 74 P: ATGCAGCCAGATCTCGGCGAAGTAAA 200 122 bp
  13 to 15 junction 2,182 F: TCACTTTTTCAAGCAGTAGGAATTATTTAG 600  
  15 2,330 R: TAATTCTTCACCCTGCAGTAGGTTT 600  
HIF-1α 736 15 2,260 P: TGACCAGTTATGATTGTGAAGTTAATGCTCCTATACAAGG 200 149 bp
  11 1,566 F: TGTGGATAGTGATATGGTCAATGAATT 300  
  13 1,699 R: TAGTATCTTTGGATTTAGTTCTTCCTCAGG 300  
HIF-1α 557 11 to 13 junction 1,642 P: AAGCAAACCCATTTTCTACTCAGAACTACA 200 134 bp
  10 1,490 F: AGACACCTAGTCCTTCCGATGG 600  
  13 1,580 R: AAGCTAGTATCTTTGGATTTAGTTCTTCCT 600  
HIF-1α 516 10 to 13 junction 1,513 P: AGCACTAGACAAAGTTCACCTGAGAACTACAGT 200 91 bp
  1. The mRNA sequences of four alternatively spliced variants (HIF-1α TAG, HIF-1α 736, HIF-1α 557and HIF-1α 516) were constructed using the human HIF-1α transcript sequence NM_001530. bp = base pairs; F = forward primer; P = oligonucleotide probe; R = reverse primer.