Skip to main content

Table 1 Oligonucleotide sequences used in the dual reporter gene assay, corresponding to the Y122X, G542X, R1162X and W1292X mutations and the TQ in frame control. Readthrough level before and after incubation with 600 μg/ml gentamicin

From: Correction to: In vitro prediction of stop-codon suppression by intravenous gentamicin in patients with cystic fibrosis: a pilot study

Mutation Oligonucleotide 0 600
Y122X w 5’ TCTATCGCGATTTAACTAGGCATAGGC 3′
c 5’ GCCTATGCCTAGTTAAATCGCGATAGA 3′
0.02 0.12
W1282X w 5’ACTTTGCAACAGTGAAGGAAAGCCTTT 3′
c 5’AAAGGCTTTCCTTCACTGTTGCAAAGT 3’
0.115 0. 35
R1162X w 5’CGATCTGTGAGCTGAGTCTTTAAGTTC 3′
c 5’GAACTTAAAGACTCAGCTCACAGATCG 3′
0.023 0.22
G542X w 5’AATATAGTTCTTTGAGAAGGTGGAATC 3′
c 5’GATTCCACCTTCTCAAAGAACTATATT 3′
0.017 0.26