Skip to main content

Table 1 Primers used to quantify gene expression levels

From: Bevacizumab dose adjustment to improve clinical outcomes of glioblastoma

 Forward 5′→3′Reverse 5′→3′
Human primers
VEGFACTAACACTCAGCTCTGCCCACACACAAATACAAGTTGCCAA
GAPDHTCCTCCACCTTTGACGCTGACCACCCTGTTGCTGTAGCC
β-actinCATCCCCCAAAGTTCACAATATGGCAAGGGACTTCCTGTA
β-2 microglobulinTTCTACTTTGAGTGCTGTCTCCAATTCTCTGCTCCCCACCTCT
Mouse primers
VEGFAACACGGTGGTGGAAGAAGAGGGAAGGGAAGATGAGGAAGG
VEGF-BTATCTCCCAGAGCTGCCATCCCCAAATCCCGTTATTGGTA
VEGFR-2GGCAGTGTCTGAGGGTTCTCTGGAGAGCAAACCAACCAAT
CD31CGGTTTCCTAAGGTCTGAGCGAGAAGGCGAGGAGGGTTAG
vWFCAATGGCTCTGTCGTGTACCCAAGGGAGGGATCTGGTTTT
GAPDHTGGCATCCTTGCTTACACAGGCAATTCCAGCCTTAGCATC
β-actinAATTTCTGAATGGCCCAGGTGCTGCCTCAACACCTCAAC
β-2 microglobulinGCACGCAGAAAGAAATAGCACAGAGGGTTTGGCATATGAT