Skip to main content

Table 1 Oligonucleotide primers and PCR conditions of rat and human in real-time quantitative PCR

From: Dexamethasone induces an imbalanced fetal-placental-maternal bile acid circulation: involvement of placental transporters

Genes Forward primer (5′-3′) Reverse primer (3′-5′) Annealing
Rat
GR CACCCATGATCCTGTCAGTC AAAGCCTCCCTCTGCTAACC 61 °C, 30 s
FXR GATGTCTTGGAGGGTGAATG GAGTGAGACCTGGTACAAATG 60 °C, 30 s
Oatp2b1 TGTCTGCCGCTACTATGA CTTGTAGGTCTGAGCTCTTTAC 60 °C, 30 s
Bcrp GAGCCTTCCAAGAGAGAGA CTGATGACAGAACGAGGTAAC 60 °C, 30 s
Oatp4a1 GGTGTGACAACTGGCTATG GCATAGCAGGGAGAGTAGTA 60 °C, 30 s
Mrp4 GTGTTGGACAGAGACAGTTAG TGTGAGCAATGGTGAGAAC 60 °C, 30 s
Cyp7a1 CCATAAGGTGTTGTGCCACGGAAA GCCCAAATGCCTTCGCAGAAG 60 °C, 30 s
Cyp27a11 ACTGCACCAGTTACAGGTGCTTTACA CCATGTCGTTCCGTACTGGGTACT 60 °C, 30 s
Slc27a5 GGAGATCACAAACACCTACAA CCTTGTTGTCCAGTATGTAGAG 60 °C, 30 s
GAPDH GCAAGTTCAATGGCACAG GCCAGTAGACTCCACGACA 60 °C, 30 s
Human
GR GTTACACAGGCTTCAGGTATC TGGAGTTTCCTTCCCTCTT 60 °C, 30 s
FXR CCAAAGTCATCTCCTACTTCAG CAGTGTCTTCCAAGCAGTAG 60 °C, 30 s
OATP2B1 CCCAGCACTCGTGTGGAATA GCACGTTGAGTCGCAGGAT 60 °C, 30 s
BCRP GTCAGAGTGTGGTTTCTGTAG TGCTGCAAAGCCGTAAA 60 °C, 30 s
OATP4A1 CTGTATCCCTCAGAATCTTTCC CATCGTAGAGTTGCCGTTAG 60 °C, 30 s
MRP4 GTTGGCATTGTGGGAAGA CAGGTTCCTGAGGTATGATTG 60 °C, 30 s
GAPDH GGGAAGCTCAAGGGAGATA CTAAGAGACAAGAGGCAAGAAG 60 °C, 30 s
  1. GR glucocorticoid receptor, FXR farnesoid X receptor, Oatp2b1/OATP2B1 organic anion transporter polypeptide-related protein 2b1, Bcrp/BCRP breast cancer resistance protein, Oatp4a1/OATP4A1 organic anion transporter polypeptide-related protein 4a1, Mrp4/MRP4 multidrug resistance-associated proteins 4, Cyp7a1 cytochrome P450 family 7 subfamily A member 1, Cyp27a1 cytochrome P450 family 27 subfamily A member 1, Slc27a5 solute carrier family 27 member 5, GAPDH glyceraldehyde-3-phosphate dehydrogenase
\