Skip to main content

Table 1 Oligonucleotide primers and PCR conditions of rat and human in real-time quantitative PCR

From: Dexamethasone induces an imbalanced fetal-placental-maternal bile acid circulation: involvement of placental transporters

Genes

Forward primer (5′-3′)

Reverse primer (3′-5′)

Annealing

Rat

GR

CACCCATGATCCTGTCAGTC

AAAGCCTCCCTCTGCTAACC

61 °C, 30 s

FXR

GATGTCTTGGAGGGTGAATG

GAGTGAGACCTGGTACAAATG

60 °C, 30 s

Oatp2b1

TGTCTGCCGCTACTATGA

CTTGTAGGTCTGAGCTCTTTAC

60 °C, 30 s

Bcrp

GAGCCTTCCAAGAGAGAGA

CTGATGACAGAACGAGGTAAC

60 °C, 30 s

Oatp4a1

GGTGTGACAACTGGCTATG

GCATAGCAGGGAGAGTAGTA

60 °C, 30 s

Mrp4

GTGTTGGACAGAGACAGTTAG

TGTGAGCAATGGTGAGAAC

60 °C, 30 s

Cyp7a1

CCATAAGGTGTTGTGCCACGGAAA

GCCCAAATGCCTTCGCAGAAG

60 °C, 30 s

Cyp27a11

ACTGCACCAGTTACAGGTGCTTTACA

CCATGTCGTTCCGTACTGGGTACT

60 °C, 30 s

Slc27a5

GGAGATCACAAACACCTACAA

CCTTGTTGTCCAGTATGTAGAG

60 °C, 30 s

GAPDH

GCAAGTTCAATGGCACAG

GCCAGTAGACTCCACGACA

60 °C, 30 s

Human

GR

GTTACACAGGCTTCAGGTATC

TGGAGTTTCCTTCCCTCTT

60 °C, 30 s

FXR

CCAAAGTCATCTCCTACTTCAG

CAGTGTCTTCCAAGCAGTAG

60 °C, 30 s

OATP2B1

CCCAGCACTCGTGTGGAATA

GCACGTTGAGTCGCAGGAT

60 °C, 30 s

BCRP

GTCAGAGTGTGGTTTCTGTAG

TGCTGCAAAGCCGTAAA

60 °C, 30 s

OATP4A1

CTGTATCCCTCAGAATCTTTCC

CATCGTAGAGTTGCCGTTAG

60 °C, 30 s

MRP4

GTTGGCATTGTGGGAAGA

CAGGTTCCTGAGGTATGATTG

60 °C, 30 s

GAPDH

GGGAAGCTCAAGGGAGATA

CTAAGAGACAAGAGGCAAGAAG

60 °C, 30 s

  1. GR glucocorticoid receptor, FXR farnesoid X receptor, Oatp2b1/OATP2B1 organic anion transporter polypeptide-related protein 2b1, Bcrp/BCRP breast cancer resistance protein, Oatp4a1/OATP4A1 organic anion transporter polypeptide-related protein 4a1, Mrp4/MRP4 multidrug resistance-associated proteins 4, Cyp7a1 cytochrome P450 family 7 subfamily A member 1, Cyp27a1 cytochrome P450 family 27 subfamily A member 1, Slc27a5 solute carrier family 27 member 5, GAPDH glyceraldehyde-3-phosphate dehydrogenase