Skip to main content

Table 1 Primers used for real-time PCR

From: Gut microbiota in children with type 1 diabetes differs from that in healthy children: a case-control study

Target group Oligonucleotide sequence (5′-3′) Reference Amplicon size (bp)
Bacteroidetes CATGTGGTTTAATTCGATGAT Guo et al. 2008 [30] 126
  AGCTGACGACAACCATGCAG   
Bacteroides GAGAGGAAGGTCCCCCAC Guo et al. 2008 [30] 106
  CGCTACTTGGCTGGTTCAG   
Lactobacillus GAGGCAGCAGTAGGGAATCTTC Delroisse et al. 2008 [31] 126
  GGCCAGTTACTACCTCTATCCTTCTTC   
Fusobacterium CCCTTCAGTGCCGCAGT Friswell et al. 2010 [32] 273
  GTCGCAGGATGTCAAGAC   
Firmicutes ATGTGGTTTAATTCGAAGCA Guo et al. 2008 [30] 126
  AGCTGACGACAACCATGCAC   
Actinobacteria CGCGGCCTATCAGCTTGTTG Stach et al. 2003 [33] 600
  CCGTACTCCCCAGGCGGGG   
Bifidobacterium CTCCTGGAAACGGGTGG Matsuki et al. 2004 [34] 550
  GGTGTTCTTCCCGATATCTACA   
Prevotella GGTTCTGAGAGGAAGGTCCCC Bekele et al. 2010 [35] 121
  TCCTGCACGCTACTTGGCTG   
Enterococcus CCCTTATTGTTAGTTGCCATCATT Rinttilä et al. 2004 [36] 144
  ACTCGTTCTTCCCATGT   
Proteobacteria CATGACGTTACCCGCAGAAGAAG Friswell et al. 2010 [32] 195
  CTCTACGAGACTCAAGCTTGC   
ClostridiumCluster IV GCACAAGCAGTGGAGT Matsuki et al. 2004 [34] 239
  CTTCCTCCGTTTTGTCAA   
Blautia coccoides-Eubacterium rectale group CGGTACCTGACTAAGAAGC Rinttilä et al. 2004 [36] 429
  AGTTTCATTCTTGCGAACG   
Veillonella ACCAACCTGCCCTTCAGA Rinttilä et al. 2004 [36] 343
  CGTCCCGATTAACAGAGCTT   
β-globin GAAGAGCCAAGGACAGGTAC Fredricks et al. 2007 [37] 270
  CAACTTCATCCACGTTCACC